Prev. |  Human A to Z list >  A >  ATG4B > 

ARh07A10 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR122810
Clone Name ARh07A10
Clone info. Plasmid clone of human APG4B cDNA with SV40 promoter
Vector Click for information pGCAP1
5'-terminal sequence(1) GGTCGGCGGCCGGACTGGGAAGATGGACGCAGCTACTCTGACCTACGACACTCTCCGGTT
Sequence, submitted(2) n.a.
 
Sequence, refered NM_013325.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ATG4B (NCBI Gene 23192)  other clone of ATG4B in our bank
Synonyms APG4B|AUTL1
Protein Name autophagy related 4B cysteine peptidase
KEGG hsa:23192
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR122810 ARh07A10 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARh07A10a.seq   ARh07A10c.seq   ARh07A10.pdf

References and tips

Featured content

Reference


2018.10.13

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl