ARh07A10 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR122810 Clone Name ARh07A10 Clone info. Plasmid clone of human APG4B cDNA with SV40 promoter Vector Click for information pGCAP1 5'-terminal sequence(1) GGTCGGCGGCCGGACTGGGAAGATGGACGCAGCTACTCTGACCTACGACACTCTCCGGTT Sequence, submitted(2) n.a.   Sequence, refered NM_013325.4 (NCBI RefSeq mRNA) Gene Symbol and ID(3) ATG4B (NCBI Gene 23192)  other clone of ATG4B in our bank Synonyms APG4B|AUTL1 Protein Name autophagy related 4B cysteine peptidase KEGG hsa:23192

Links   NCBI Gene   NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

References and tips

Featured content

Reference

2018.10.13