Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - ARe95G03

Ordering information ordering information
Catalog Number HKR078147
Clone Name ARe95G03
Vector plasmidClick for information pKA1U5
Description Plasmid clone of human RPL37A (upstream, opposite) cDNA with SV40 promoter
5'-terminal sequence(1) GAGGCGGCCTCCTGAGAAATGTTTGCAATTGTAAGGCGTCTCTCTCATCCAGGTTTACCC
Sequence, submitted(2) AB371502 link 01
 
HP ID HP10996  finder other clones in this HP group.
Sequence, refered
Gene ID
Gene Symbol   finder other clones with this gene.
Protein Name
KEGG link 01
Links

Restriction map is not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips


2017.02.23

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_160109.pl