ARe62F10 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR064930 Clone Name ARe62F10 Clone info. Plasmid clone of human C16orf68 cDNA with SV40 promoter Vector Click for information pKA1U5 5'-terminal sequence(1) GGTTATGGCGGCCGCCTAAGTCCCACAGAGACGGGAGTCGGGTGGGATCCCAGGCTGGGC Sequence, submitted(2) n.a.   Sequence, refered NM_024109.2 (NCBI RefSeq mRNA) Gene Symbol and ID(3) METTL22 (NCBI Gene 79091)  other clone of METTL22 in our bank Synonyms C16orf68 Protein Name methyltransferase like 22 KEGG hsa:79091

Links   NCBI Gene   NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2018.11.19