ARe49E06 - NRCD Human cDNA Clone

Catalog Number HKR059702 Clone Name ARe49E06 Clone info. Plasmid clone of human OTUD6B (upstream, opposite) cDNA with SV40 promoter Vector(1) pKA1U5 5'-terminal sequence(2) TGGACGTGAGGCGCGCAGAGATGGCGTAACGGGAATAGTTTTCAACGTCTATTTCATTCC Sequence, submitted(3) AB371438 [link]   Sequence, refered BC105990.1 HP ID HP05485   other clones in this HP group. Protein Name

Links   DDBJ/EMBL/GenBank

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2023.05.02