Recombinant Virus Database STS Markers 2004-06-24
VID  S00796
VAC  1059 bp   cycles  
Name of virus  Adenovirus (Ad)
target region/gene E1B
primer 1 E1BF2
  GenBank
  position
ACACAAGAATCGCCTGCTACTGTTGTCTTCCGTCC
primer 2 E1BR2
  GenBank
  position
TGCGAGAGTGGCTGGCTACGTGAATGGTCTTCAGC
sequence
Reference 00483  Suzuki,2004,Oncol. Rep.
PubMed 14654922
comment