|
Recombinant Virus Database STS Markers |
2004-05-11 |
|
|
VID |
|
|
S00555 |
|
|
VAC |
|
|
|
|
bp |
cycles |
|
|
Name of virus |
|
|
Equine arteritis viruses (EAV) |
|
|
target region/gene |
|
|
replicase gene |
|
|
primer 1 |
|
|
EAV24 |
|
|
GenBank |
|
|
|
|
|
position |
|
|
|
|
|
|
|
|
TTTGAACCTTATCTACACCCTGA
|
|
|
primer 2 |
|
|
EAV25 |
|
|
GenBank |
|
|
|
|
|
position |
|
|
|
|
|
|
|
|
CTCTAGTGCACAAATGGTCTG
|
|
|
sequence |
|
|
|
|
|
Reference |
|
|
00376 Stadejek T,1999,J Gen Virol |
|
|
PubMed |
|
|
10092009 |
|
|
comment |
|
|
|
|
|
|
♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
