Prev. |  KEGG KO K20868 > 

RIKEN DNA Bank Human Resource - ATG16L2

Gene ID NCBI Gene 89849 |  KEGG hsa:89849
Gene Symbol ATG16L2
Protein Name autophagy related 16 like 2
Synonyms ATG16B|WDR80
Featured content Autophagy (human)
Ortholog resource in our bank

  ATG16L2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093523 IRAL033N11 pOTB7 BC036713 NM_033388 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081644 M01C004B20 pDONR221 04-134-2_2-H10 AK093017 NM_033388  
HGE081692 M01C004D20 pDONR221 04-134-2_2-H10 AK093017 NM_033388  
HGE081740 M01C004F20 pDONR221 04-134-2_2-H10 AK093017 NM_033388  
HGE081788 M01C004H20 pDONR221 04-134-2_2-H10 AK093017 NM_033388  
HGE081836 M01C004J20 pDONR221 04-134-2_2-H10 AK093017 NM_033388  
HGE081884 M01C004L20 pDONR221 04-134-2_2-H10 AK093017 NM_033388  
HGE081932 M01C004N20 pDONR221 04-134-2_2-H10 AK093017 NM_033388  
HGE081980 M01C004P20 pDONR221 04-134-2_2-H10 AK093017 NM_033388  
HGE110827 M01C077B03 pDONR221 06-2_02-C02 AK093017 NM_033388  
HGE110875 M01C077D03 pDONR221 06-2_02-C02 AK093017 NM_033388  
HGE110923 M01C077F03 pDONR221 06-2_02-C02 AK093017 NM_033388  
HGE110971 M01C077H03 pDONR221 06-2_02-C02 AK093017 NM_033388  
HGE111019 M01C077J03 pDONR221 06-2_02-C02 AK093017 NM_033388  
HGE111067 M01C077L03 pDONR221 06-2_02-C02 AK093017 NM_033388  
HGE111115 M01C077N03 pDONR221 06-2_02-C02 AK093017 NM_033388  
HGE111163 M01C077P03 pDONR221 06-2_02-C02 AK093017 NM_033388  
HGE085203 M01C013A03 pDONR221 FLJ04-A02 AK093017 NM_033388  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054579 ARe36H11 pKA1U5 NM_033388.1  
GGTCCTGGGCGGGAGGAACGCGCCGCTAGGCGGGATAGCGCGGCCATGGCGGGGCCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl