Prev. |  KEGG KO K08343 > 

RIKEN DNA Bank Human Resource - ATG3

Gene ID NCBI Gene 64422 |  KEGG hsa:64422
Gene Symbol ATG3
Protein Name autophagy related 3
Synonyms APG3|APG3-LIKE|APG3L|PC3-96
Featured content Autophagy (human)
Ortholog resource in our bank

  ATG3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030734 IRAK076N22 pBluescriptR BC043267 NM_022488
HGY085018 IRAL012J02 pOTB7 BC002830 NM_022488
HGY090073 IRAL025D01 pOTB7 BC024221 NM_022488

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043699 ARe09E03 pKA1U5 NM_022488.3  
GGCTGCCAGCCGGGTGCTGATGCGAGTCGGTGGCAGCGAGGACATTTTCTGACTCCCTGG
HKR052084 ARe30D12 pKA1U5 NM_022488.3  
GAGACAGCTCCCAGAGGGCGAGGGGTGCGTGTGCGTCCGCTTCTCACCTCAGGTCTCCCT
HKR264402 ARiS161A02 pGCAP10 NM_022488.3  
GAAGAGAGTGAGAAGGAAGGGAAGCCGGAAGGGGCGCGAGTGAAGCAAAGCGAGGACAGA
HKR396484 RBd91D12 pGCAP10 NM_022488.3  
GAGTGTCACGTGAGGCCCCGGTGGCGGCGCAGCTACGGCAAGAGAGTGAGAAGGAAGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl