Prev. |  KEGG KO K19730 > 

RIKEN DNA Bank Human Resource - ATG101

Gene ID NCBI Gene 60673 |  KEGG hsa:60673
Gene Symbol ATG101
Protein Name autophagy related 101
Synonyms C12orf44
Featured content Autophagy (human)
Ortholog resource in our bank

  ATG101

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19626 pEGFP-C1-hATG101 Transient expression vector of human ATG101 with N-terminal EGFP.
RDB19773 p3xFLAG-CMV10-hAtg101 Transient expression vector of human Atg101 with N-terminal 3×FLAG.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082926 IRAL007F06 pOTB7 BC005151 NM_021934
HGY087145 IRAL017O09 pOTB7 BC009937 NM_021934 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442375 RBdS105P15 pGCAP10 NM_001098673.1  
GGGGAGAGTGGTGGCATCTGAGAGGCTGGTCGTGGACTGTGGTTGGGGGAGGTGGGAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.07.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl