Prev. |  KEGG KO K04354 > 

RIKEN DNA Bank Human Resource - PPP2R2D

Gene ID NCBI Gene 55844 |  KEGG hsa:55844
Gene Symbol PPP2R2D
Protein Name protein phosphatase 2 regulatory subunit Bdelta
Synonyms B55D|B55delta|MDS026
Featured content Hippo signaling (human)
Featured content Sphingolipid signaling pathway (human)
Ortholog resource in our bank

  PPP2R2D

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036408 IRAK091A08 pBluescript BC047379 NM_001003656 Full
HGX047980 IRAK119P20 pCMV-SPORT6 BC058076 NM_001003656 Full/var
HGY053378 IRAK133H10 pBluescript BC060885 NM_001003656 Full/var
HGX069767 IRAK174G23 pCMV-SPORT6 BC072402 NM_001003656 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184806 ARi62A06 pGCAP10 NM_018461.2  
GATCGAGCGGGGCGACGGGCATTGGGCGCCATTTTGAAAAGGGAAAAAAATCCCTCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl