Prev. |  KEGG KO K17603 > 

RIKEN DNA Bank Human Resource - ZFYVE1

Gene ID NCBI Gene 53349 |  KEGG hsa:53349
Gene Symbol ZFYVE1
Protein Name zinc finger FYVE-type containing 1
Synonyms DFCP1|PPP1R172|SR3|TAFF1|ZNFN2A1
Featured content Autophagy (human)
Ortholog resource in our bank

  ZFYVE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006285 IRAK015L21 pCMV-SPORT6 BC014902 NM_021260 Full/var
HGX037511 IRAK093M23 pCMV-SPORT6 BC053520 NM_178441 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044034 ARe10B10 pKA1U5 NM_021260.1  
GGACAACAGGAGAGGAGGAAGCCCGGGAGGCAACGAAGGAGGAGGGTGGCGGAGATGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl