Prev. |  KEGG KO K04710 > 

RIKEN DNA Bank Human Resource - CERS2

Gene ID NCBI Gene 29956 |  KEGG hsa:29956
Gene Symbol CERS2
Protein Name ceramide synthase 2
Synonyms L3|LASS2|SP260|TMSG1
Featured content Sphingolipid signaling pathway (human)
Ortholog resource in our bank

  CERS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081609 IRAL004A09 pOTB7 BC001357 NM_181746 Full
HGY090867 IRAL027C19 pOTB7 BC010032 NM_181746 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366528 RBd16F08 pGCAP10 NM_181746.2  
GGGGCGGAAGAGGGAGGAGAGGCGCGGGGAGCCAGGCCTCGGGGCCTCGGAGCAACCACC
HKR475043 RBdS187K03 pGCAP10 NM_181746.2  
GGCGGGGAGCCAGGCCTCGGGGCCTCGGAGCAACCACCCGAGCAGACGGAGTACACGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl