Prev. |  KEGG KO K03362 > 

RIKEN DNA Bank Human Resource - FBXW11

Gene ID NCBI Gene 23291 |  KEGG hsa:23291
Gene Symbol FBXW11
Protein Name F-box and WD repeat domain containing 11
Synonyms BTRC2|BTRCP2|FBW1B|FBXW1B|Fbw11|Hos
Featured content Circadian clock (human)
Featured content Hippo signaling (human)
Featured content Hedgehog signaling (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  FBXW11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011014 IRAK027I22 pCMV-SPORT6 BC026213 NM_033644 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402925 RBdS007F05 pGCAP10 NM_012300.2  
GGTGCGATAGCCGCCTCCGCCTCTGCCGCCTCCGCCGTCGCCTCCTCCGCCCGGGCCGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl