Prev. |  KEGG KO K06633 > 

RIKEN DNA Bank Human Resource - PKMYT1

Gene ID NCBI Gene 9088 |  KEGG hsa:9088
Gene Symbol PKMYT1
Protein Name protein kinase, membrane associated tyrosine/threonine 1
Synonyms MYT1|PPP1R126
Featured content Rb pathway
Ortholog resource in our bank

  PKMYT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022555 W01A056G11 pENTR-TOPO flj0052f06 AK098452 NM_182687  
HGE022559 W01A056G15 pENTR-TOPO flj0052f06 AK098452 NM_182687  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR370552 RBd26G08 pGCAP10 NM_004203.3 done
TAAGGCGTTCACGGGCCGTTCCCCCTCACGGGAGTCCTCCGCCCGGGCGTCCGGAACAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl