Prev. |  KEGG KO K02633 > 

RIKEN DNA Bank Human Resource - PER3

Gene ID NCBI Gene 8863 |  KEGG hsa:8863
Gene Symbol PER3
Protein Name period circadian regulator 3
Synonyms FASPS3|GIG13
Featured content Circadian clock (human)
Ortholog resource in our bank

  PER3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15084 human Period3 (-3.1 - +0.2 kb)_luciferase/pENTR-1A Gateway(R) entry vector with human Period 3 [-3.1 to +0.2 kb]-luciferase fragment.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR430149 RBdS075G05 pGCAP10 NM_016831.1  
GGCCCCAGGGCCAATGGAGGCCTGCGGAGTCGGCCCCGACGACCAATCGCGCGGCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.01

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl