Prev. |  KEGG KO K07861 > 

RIKEN DNA Bank Human Resource - RAC3

Gene ID NCBI Gene 5881 |  KEGG hsa:5881
Gene Symbol RAC3
Protein Name Rac family small GTPase 3
Synonyms -
Featured content Wnt signaling pathway (human)
Featured content Sphingolipid signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Axon guidance - human
Ortholog resource in our bank

  RAC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088420 IRAL021A20 pDNR-LIB BC015197 NM_005052 Full
HGY088622 IRAL021J06 pDNR-LIB BC009605 NM_005052 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182932 ARi57F12 pGCAP10 NM_005052.2  
GGGGCATTTCTCCGCAGCTCGGCTCGCGGCCGCGCCCGCCGCCGCCCGGCCCGCGCCCAT
HKR321651 RBb04C03 pKA1U5 NM_005052.2  
ATTTCTCCGCAGCTCGGCTCGCGGCCGCGCCCGCCGCCGCCCGGCCCGCGCCCATGCAGG
HKR330434 RBb26B10 pGCAP1 NM_005052.2  
TGCTGTCTCCGGCCGATTGCTCGGCGCTCGGGTCCGCGGCCGCTGCGGCGCCGGGCATTT
HKR405720 RBdS014E24 pGCAP10 NM_005052.2  
GGTCTCCGGCCGATTGCTCGGCGCTCGGGTCCGCGGCCGCTGCGGCGCCGGGCATTTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl