Prev. |  KEGG KO K07860 > 

RIKEN DNA Bank Human Resource - RAC2

Gene ID NCBI Gene 5880 |  KEGG hsa:5880
Gene Symbol RAC2
Protein Name Rac family small GTPase 2
Synonyms EN-7|Gx|HSPC022|p21-Rac2
Featured content Wnt signaling pathway (human)
Featured content Sphingolipid signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Axon guidance - human
Ortholog resource in our bank

  RAC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044022 IRAK110A22 pCMV-SPORT6 BC051899 NM_002872 Partial/var
HGY083074 IRAL007L10 pOTB7 BC001485 NM_002872 Full
HGY096299 IRAL040M11 pOTB7 BC018735 NM_002872 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097234 M01C043B10 pDONR221 MGC11-D05 BC001485 NM_002872  
HGE097282 M01C043D10 pDONR221 MGC11-D05 BC001485 NM_002872  
HGE097330 M01C043F10 pDONR221 MGC11-D05 BC001485 NM_002872  
HGE097378 M01C043H10 pDONR221 MGC11-D05 BC001485 NM_002872  
HGE097426 M01C043J10 pDONR221 MGC11-D05 BC001485 NM_002872  
HGE097474 M01C043L10 pDONR221 MGC11-D05 BC001485 NM_002872  
HGE097522 M01C043N10 pDONR221 MGC11-D05 BC001485 NM_002872  
HGE097570 M01C043P10 pDONR221 MGC11-D05 BC001485 NM_002872  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE013767 W01A034G23 pENTR-TOPO IRAL007L10 BC001485 NM_002872  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070856 ARe77C08 pKA1U5 NM_002872.3  
GCTGCCCCACCACCGCTGCTCCTCAGCAGGCGCCTCTCAGCCTCCACACCCCTTGCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl