RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - MAPK8

Gene ID	NCBI Gene 5599 \| KEGG hsa:5599
Gene Symbol	MAPK8
Protein Name	mitogen-activated protein kinase 8
Synonyms	JNK\|JNK-46\|JNK1\|JNK1A2\|JNK21B1/2\|PRKM8\|SAPK1\|SAPK1c
Featured content	MAP kinases (human)
Featured content	Wnt signaling pathway (human)
Featured content	Sphingolipid signaling pathway (human)
Featured content	Apoptosis - human
Featured content	SARS-CoV-2 relevant human genes
Featured content	Mitophagy - human

Ortholog resource in our bank

  MAPK8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB06088	pEThsJNK1	Expression vector of human JNK1 coding sequence
RDB06089	pT7Cam_hsJNK1	Expression vector of human JNK1 coding sequence

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR444011	RBdS110A11	pGCAP10	NM_139046.4	Full
HKR444011	GACGGCCCGCGTCTCTGTTACTCAGCCGAGCGGCCGAGGCCGGACGACGCGGCTTGGATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.18

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl