Prev. |  KEGG KO K07199 > 

RIKEN DNA Bank Human Resource - PRKAB2

Gene ID NCBI Gene 5565 |  KEGG hsa:5565
Gene Symbol PRKAB2
Protein Name protein kinase AMP-activated non-catalytic subunit beta 2
Synonyms -
Featured content Circadian clock (human)
Ortholog resource in our bank

  PRKAB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046242 IRAK115K02 pCMV-SPORT6 BC053610 NM_005399 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095232 M01C038B08 pDONR221 MGC08-H04 BC053610 NM_005399  
HGE095280 M01C038D08 pDONR221 MGC08-H04 BC053610 NM_005399  
HGE095328 M01C038F08 pDONR221 MGC08-H04 BC053610 NM_005399  
HGE095376 M01C038H08 pDONR221 MGC08-H04 BC053610 NM_005399  
HGE095424 M01C038J08 pDONR221 MGC08-H04 BC053610 NM_005399  
HGE095472 M01C038L08 pDONR221 MGC08-H04 BC053610 NM_005399  
HGE095520 M01C038N08 pDONR221 MGC08-H04 BC053610 NM_005399  
HGE095568 M01C038P08 pDONR221 MGC08-H04 BC053610 NM_005399  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175650 ARi39C02 pGCAP10 NM_005399.3  
GAGTGGCCCTTGGAGGAGGGAGCGCATCGCCCGAGGTGGTCCCCGACGAGCTGCAGCCAT
HKR372083 RBd30D11 pGCAP10 NM_005399.3  
GATCACATCAGTGGCCCTTGGAGGAGGGAGCGCATCGCCCGAGGTGGTCCCCGACGAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl