Prev. |  KEGG KO K11584 > 

RIKEN DNA Bank Human Resource - PPP2R5C

Gene ID NCBI Gene 5527 |  KEGG hsa:5527
Gene Symbol PPP2R5C
Protein Name protein phosphatase 2 regulatory subunit B'gamma
Synonyms B56G|B56gamma|PR61G
Featured content Sphingolipid signaling pathway (human)
Ortholog resource in our bank

  PPP2R5C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093681 IRAL034D09 pOTB7 BC016183 NM_178588 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010420 W01A026A20 pENTR-TOPO X01Y113E21 AK131391 NM_178588  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178480 ARi46D08 pGCAP10 NM_002719.2  
GGTCTTTTTTTTTTTAAACTAAAATGGAGGCTGGTTTCTTGCCTTAAGGAGCCCATTGCC
HKR185601 ARi64A01 pGCAP10 NM_002719.2  
GTTNTCTNTNNNTTAACTAAATGANGCTGNTTTCTNNNNTNNNANCCATTGCTTCCGCTG
HKR378572 RBd46H04 pGCAP10 NM_002719.2  
GGTCTTTTTTTTTTTAAACTAAAATGGAGGCTGGTTTCTTGCCTTAAGGAGCCCATTGCC
HKR396545 RBd91G01 pGCAP10 NM_002719.2  
GAGTTCCCTCCAGCTGCAGAGAGCTTCAGTTTGTCTTTTTTTTTTAAACTAAAATGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl