Prev. |  KEGG KO K11583 > 

RIKEN DNA Bank Human Resource - PPP2R3A

Gene ID NCBI Gene 5523 |  KEGG hsa:5523
Gene Symbol PPP2R3A
Protein Name protein phosphatase 2 regulatory subunit B''alpha
Synonyms PPP2R3|PR130|PR72
Featured content Sphingolipid signaling pathway (human)
Ortholog resource in our bank

  PPP2R3A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056301 IRAK140M13 pCMV-SPORT6 BC065531 NM_002718 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096035 M01C040B11 pDONR221 MGC09-G06 BC065531 NM_002718  
HGE096083 M01C040D11 pDONR221 MGC09-G06 BC065531 NM_002718  
HGE096131 M01C040F11 pDONR221 MGC09-G06 BC065531 NM_002718  
HGE096179 M01C040H11 pDONR221 MGC09-G06 BC065531 NM_002718  
HGE096227 M01C040J11 pDONR221 MGC09-G06 BC065531 NM_002718  
HGE096275 M01C040L11 pDONR221 MGC09-G06 BC065531 NM_002718  
HGE096323 M01C040N11 pDONR221 MGC09-G06 BC065531 NM_002718  
HGE096371 M01C040P11 pDONR221 MGC09-G06 BC065531 NM_002718  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077770 ARe94H02 pKA1U5 NM_002718.3  
GGGGCGGGGCGCGCTCGGGCCTCCGCTCTTCACGCGCCGCATTCGTAGCCCGAGAGTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl