Prev. |  KEGG KO K05858 > 

RIKEN DNA Bank Human Resource - PLCB4

Gene ID NCBI Gene 5332 |  KEGG hsa:5332
Gene Symbol PLCB4
Protein Name phospholipase C beta 4
Synonyms ARCND2|PI-PLC
Featured content Wnt signaling pathway (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  PLCB4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042954 ARe07G10 pKA1U5 NM_000933.2(5' ONLY)  
GAGCAGCTCCAGGCAAAGTGACAGAGGACAGTGCTGCTGTGAGTTTGACGAAGTGGACAT
HKR062105 ARe55E09 pKA1U5 NM_000933.2(5' ONLY)  
GACGCACACGCACACACGGGCGCGCACACACACGCNCGNTACACACTGGGTCTCCAGGCA
HKR180025 ARi50B01 pGCAP10 NM_000933.2(5' ONLY)  
GGGGCTCGCGGCAACTGGGCGGCCGGCCCGGCCCCTGCCCACCCCCAGCCCAGCCCGGCG
HKR264726 ARiS161N14 pGCAP10 NM_000933.2(5' ONLY)  
GGCCGGGAGCAGTAAGTGAGCTGCACCGCCAACAAGATCTCTCACACACAGACACACACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl