Prev. |  KEGG KO K02649 > 

RIKEN DNA Bank Human Resource - PIK3R2

Gene ID NCBI Gene 5296 |  KEGG hsa:5296
Gene Symbol PIK3R2
Protein Name phosphoinositide-3-kinase regulatory subunit 2
Synonyms MPPH|MPPH1|P85B|p85|p85-BETA
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Jak-STAT signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Axon guidance - human
Featured content Apoptosis - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  PIK3R2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067500 IRAK168M12 pBluescriptR BC070082 NM_005027
HGY091498 IRAL028M10 pOTB7 BC011917 NM_005027 Partial
HGY092196 IRAL030I04 pOTB7 BC014170 NM_005027 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050500 ARe26E04 pKA1U5 NM_005027.2  
ATCCTGTGGGGAGCCACGGGGCGGGCTTGGCTTGGTGTGACGGCGGCTGCGGCGGCGGTG
HKR186076 ARi65D04 pGCAP10 NM_005027.2  
GGGCGGCTGCGGCGGCGGTGGCGGCCGCGACCAGGTCGGCGTCCTCAGCTGGCCGAGCAT
HKR380479 RBd51D07 pGCAP10 NM_005027.2  
GGGGGATCCCGCGGCTGCGGCGACGGTGGCCGCGGTGGAGCCACGGGGCGGGCTTGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl