Prev. |  KEGG KO K00922 > 

RIKEN DNA Bank Human Resource - PIK3CB

Gene ID NCBI Gene 5291 |  KEGG hsa:5291
Gene Symbol PIK3CB
Protein Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms P110BETA|PI3K|PI3KBETA|PIK3C1
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Jak-STAT signaling pathway (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Axon guidance - human
Featured content Apoptosis - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  PIK3CB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001314 IRAK003E18 pCMV-SPORT6 BC003393 NM_006219 Partial
HGY095244 IRAL038B20 pDNR-LIB BC022049 NM_006219 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR373347 RBd33G03 pGCAP10 NM_006219.1  
GGGCGGCGGCGCGCGCGTGCTCTGTCGGCCTGTGCGGCGCTGCGGCGGAGCGGGCCATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl