Prev. |  KEGG KO K06276 > 

RIKEN DNA Bank Human Resource - PDPK1

Gene ID NCBI Gene 5170 |  KEGG hsa:5170
Gene Symbol PDPK1
Protein Name 3-phosphoinositide dependent protein kinase 1
Synonyms PDK1|PDPK2|PDPK2P|PRO0461
Featured content Sphingolipid signaling pathway (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content T cell receptor signaling pathway (human)
Featured content Apoptosis - human
Ortholog resource in our bank

  PDPK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001841 IRAK004K01 pCMV-SPORT6 BC000789 NM_031268
HGX020701 IRAK051M13 pCMV-SPORT6 BC033494 NM_031268 Full
HGY028981 IRAK072H13 pBluescriptR BC040324 NM_002613 Partial
HGY086804 IRAL017A04 pOTB7 BC006339 NM_031268 Full
HGY087851 IRAL019K11 pDNR-LIB BC012540 NM_031268 Partial/var
HGY091718 IRAL029E22 pOTB7 BC012103 NM_002613 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066555 ARe66G11 pKA1U5 NM_002613.3  
GGAGGGCGGCCATTGCTGGGGCTCCGCTTCGGGGAGGAGGACGCTGAGGAGGCGCCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl