Prev. |  KEGG KO K07828 > 

RIKEN DNA Bank Human Resource - NRAS

Gene ID NCBI Gene 4893 |  KEGG hsa:4893
Gene Symbol NRAS
Protein Name NRAS proto-oncogene, GTPase
Synonyms ALPS4|CMNS|KRAS|N-ras|NCMS|NRAS1|NS6
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Axon guidance - human
Featured content Apoptosis - human
Featured content Mitophagy - human
Ortholog resource in our bank

  NRAS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07042 pENTR-hsNRAS Plasmid vector of human NRAS, wild-type
RDB07046 pETHFF-hsNRAS Expression vector, bacterial, of human NRAS, wild-type, Gateway(R) expression plasmid

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086417 IRAL016A17 pDNR-LIB BC005219 NM_002524 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004741 W01A011O05 pENTR-TOPO IRAL016A17 BC005219 NM_002524.5 full done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082147 ARf05G03 pKA1U5 NM_002524.3  
GGGGGGCTGTTCATGGCGGTTCCGGGGTCTCCAACATTTTTCCCGGCTGTGGTCCTAAAT
HKR170811 ARi27A11 pGCAP10 NM_002524.3  
GGGAAGTGCCGCTCCTTGGTGGGGGCTGTTCATGGCGGTTCCGGGGTCTCCAACATTTTT
HKR203245 ARiS008B21 pGCAP10 NM_002524.3  
GGCTCCTTGGTGGGGGCTGTTCATGGCGGTTCCGGGGTCTCCAACATTTTTCCCGGCTGT
HKR219604 ARiS049A04 pGCAP10 NM_002524.3  
GGTGGGGGCTGTTCATGGCGGTTCCGGGGTCTCCAACATTTTTCCCGGCTGTGGTCCTAA
HKR396548 RBd91G04 pGCAP10 NM_002524.3  
GGGAAGTGCCGCTCCTTGGTGGGGGCTGTTCATGGCGGTTCCGGGGTCTCCAACATTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.18

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl