Prev. |  KEGG KO K08959 > 

RIKEN DNA Bank Human Resource - CSNK1D

Gene ID NCBI Gene 1453 |  KEGG hsa:1453
Gene Symbol CSNK1D
Protein Name casein kinase 1 delta
Synonyms ASPS|CKI-delta|CKId|CKIdelta|FASPS2|HCKID
Featured content Circadian clock (human)
Featured content Hippo signaling (human)
Featured content Hedgehog signaling (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  CSNK1D

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19314 pFN21A_Halo_CK1delta Expresion vector of human CK1 delta tagged with Halo at N-terminus.
RDB19315 pFN21A_Halo_CK1delta_K38R Expresion vector of human CK1 delta kinase-dead mutant (K38R) tagged with Halo at N-terminus.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083386 IRAL008H18 pOTB7 BC003558 NM_001893 Full
HGY093616 IRAL034A16 pOTB7 BC015775 NM_139062

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023274 W01A058D02 pENTR-TOPO IRAL008H18 BC003558 NM_001893  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR334078 RBb35D06 pGCAP1 NM_139062.1  
GATCCGAGTCCATCCGCGGCGGGGAGAGGGCAAGCGGGACCGGTAGGGGCCGGAGCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl