RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - CREB1

Gene ID	NCBI Gene 1385 \| KEGG hsa:1385
Gene Symbol	CREB1
Protein Name	cAMP responsive element binding protein 1
Synonyms	CREB\|CREB-1
Featured content	Circadian clock (human)
Featured content	Huntington disease - human

Ortholog resource in our bank

  CREB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB07501	pCMFlag_hsCREB1, transcript variant A	Expression vector of human CREB1.
RDB07505	pCMFlag_hsCREB1, transcript variant B	Expression vector of human CREB1.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX005490	IRAK013M02	pCMV-SPORT6	BC010636	NM_134442	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR075351	ARe88G07	pKA1U5	NM_004379.3
HKR075351	GACTGGGCGGCGCTGGCTGGCTCCCTGGCTGCGGCTCCTCAGNTCGGCGGCGGCTGCTGC
HKR234347	ARiS085O11	pGCAP10	NM_004379.3
HKR234347	GGGCTGGCTCCCTGGCTGCGGCTCCTCAGTCGGCGGCGGCTGCTGCTGCCTGTGGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.11.28

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl