Prev. |  KEGG KO K02206 > 

RIKEN DNA Bank Human Resource - CDK2

Gene ID NCBI Gene 1017 |  KEGG hsa:1017
Gene Symbol CDK2
Protein Name cyclin dependent kinase 2
Synonyms CDKN2|p33(CDK2)
Featured content Rb pathway
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  CDK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03472 pAxCALNLhCDK2 (forward) Shuttle vector to generate rAd harboring human CDK2 (forward)
RDB03492 pAxCALNLhCDK2 (forward) Shuttle vector to generate rAd harboring human CDK2 (forward)
RDB04061 pAxCALNLhCDK2 (reverse) Shuttle vector to generate rAd harboring human CDK2 (reverse)
RDB05249 pAxCALNLhCDK2(forward) Shuttle vector to generate rAd expressing human CDK2
RDB05250 pAxCALNLhCDK2(reverse) Shuttle vector to generate rAd expressing human CDK2

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082811 IRAL007A11 pOTB7 BC003065 NM_001798 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR343656 RBb59C08 pGCAP1 NM_001798.3  
TGTCTGGTGGCGGTCGGGAACTCGGTGGGAGGCGGCAACATTGTTTCAAGTTGGCCAAAT
HKR398409 RBd96A09 pGCAP10 NM_001798.3  
GCGGGAACTCGGTGGGAGGCGGCAACATTGTTTCAAGTTGGCCAAATTGACAAGAGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl