Prev. |  KEGG KO K06634 > 

RIKEN DNA Bank Human Resource - CCNH

Gene ID NCBI Gene 902 |  KEGG hsa:902
Gene Symbol CCNH
Protein Name cyclin H
Synonyms CAK|CycH|p34|p37
Featured content DNA damage
Featured content DNA repair (human)
Ortholog resource in our bank

  CCNH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03510 pAxCALNLhCyclin H (forward) Shuttle vector to generate rAd harboring human Cyclin H (forward)
RDB04093 pAxCALNLhCyclin H (reverse) Shuttle vector to generate rAd harboring human Cyclin H (reverse)
RDB04589 SEREX clone NGO-Br-20 (ID 859) #1 SEREX clone NGO-Br-20 (ID 859) #1
RDB06416 pCMFlag_hsCCNH Expression vector of human CCNH.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086573 IRAL016H05 pDNR-LIB BC005280 NM_001239 Full
HGY092922 IRAL032F02 pDNR-LIB BC016823 NM_001239 Full
HGY093040 IRAL032J24 pDNR-LIB BC016705 NM_001239 Full
HGY094225 IRAL035J09 pDNR-LIB BC022351 NM_001239 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR124525 ARh11F05 pGCAP1 NM_001239.2  
AGGACGCTGATGCGTTTGGGTTCTCGTCTGCAGACCCTCTGGACCTGGTCACGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl